Class 12 Biology

Chapter 5 Solutions — Molecular Basis of Inheritance

Open Solutions PDF →Also seeTextbook page→

Open Solutions PDFReads in your browser→Also seeTextbook page→

Get the full experience in the app

Free practice, offline PDFs & solutions.

Already installed? Open in the app

Solutions

Overview

Step-by-step NCERT solutions for Molecular Basis of Inheritance (Chapter 5, CBSE Class 12 Biology) — every question and answer worked out in full, not just the final result. You can also read the Molecular Basis of Inheritance textbook chapter.

Solved

What these solutions cover

All 14 questions in Molecular Basis of Inheritance are solved in the PDF. Here's what's inside, exercise by exercise:

Chapter-end Exercises

Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of complementary strand in 5'→3' direction.
If the sequence of the coding strand in a transcription unit is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of mRNA.
Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
8.
Differentiate between the followings:
- (a) Repetitive DNA and Satellite DNA
- (b) mRNA and tRNA
- (c) Template strand and Coding strand
List two essential roles of ribosome during translation.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
11.
Explain (in one or two lines) the function of the followings:
- (a) Promoter
- (b) tRNA
- (c) Exons
Why is the Human Genome project called a mega project?
What is DNA fingerprinting? Mention its application.
14.
Briefly describe the following:
- (a) Transcription
- (b) Polymorphism
- (c) Translation
- (d) Bioinformatics

Sample

Worked examples

3 questions from Molecular Basis of Inheritance, solved step by step.

Chapter-end Exercises

Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.

Nitrogenous bases are the nitrogen-containing ring structures themselves (purines and pyrimidines), while nucleosides are formed when a nitrogenous base is linked to a pentose sugar via an N-glycosidic bond.

Nitrogenous bases: Adenine, Thymine, Uracil, Cytosine

Nucleosides: Cytidine (cytosine + ribose), Guanosine (guanine + ribose)

Note: Adenine, Thymine, Uracil, and Cytosine appear in the list as free bases. Cytidine and Guanosine are nucleosides (base + sugar, without a phosphate group).

Answer: Nitrogenous bases: Adenine, Thymine, Uracil, Cytosine. Nucleosides: Cytidine, Guanosine.

Chapter-end Exercises

If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

In double-stranded DNA, base pairing follows Chargaff's rules:

— Adenine (A) pairs with Thymine (T), so %A = %T

— Guanine (G) pairs with Cytosine (C), so %G = %C

— Total: %A + %T + %G + %C = 100%

Given: %C = 20%

Therefore: %G = 20% (since G pairs with C)

%A + %T + %G + %C = 100%

%A + %T = 100% − 20% − 20% = 60%

Since %A = %T:

%A = 60% ÷ 2 = 30%

Answer: Adenine = 30%

Chapter-end Exercises

If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of complementary strand in 5'→3' direction.

The complementary strand is antiparallel, so it runs 3'→5' with respect to the given strand.

Base pairing rules: A pairs with T, T pairs with A, G pairs with C, C pairs with G.

Given strand (5'→3'): ATGCATGCATGCATGCATGCATGCATGC

Complementary strand (3'→5'): TACGTACGTACGTACGTACGTACGTACG

Written in 5'→3' direction (reversed):

5'-GCATGCATGCATGCATGCATGCATGCAT-3'

Answer: 5'-GCATGCATGCATGCATGCATGCATGCAT-3'

All 14 questions in Molecular Basis of Inheritance are solved step by step in the Solutions PDF above.

Keep solving

Chapter 5 Solutions — Molecular Basis of Inheritance

Overview

What these solutions cover

Chapter-end Exercises

Worked examples

Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.

If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of complementary strand in 5'→3' direction.

More solutions in Biology

More NCERT Solutions for Class 12